ukcte

One-step fast and label-free imaging array 

One-step quick and label-free imaging array for multiplexed detection of hint avian influenza viruses

Fast and low-cost analysis of a number of infectious illnesses is of nice significance particularly in densely populated or resource-constrained settings. Herein, we developed a one-step quick and label-free imaging array for multiplexed detection of hint avian influenza virus (AIV) DNA biomarkers. By designing a sequence of particular and environment friendly catalytic hairpin meeting (CHA) amplification reactions and using thioflavin T, a selected G-quadruplex fluorescence probe, three subtypes of AIV DNA biomarkers (H1N1, H7N9 and H5N1) had been concurrently and shortly detected inside solely 20 min, which simply wanted a small reagent quantity of 50 μL and a smartphone as a substitute of a spectrometer.

With the mixture of fluorescence imaging output and grey-level evaluation, the array sensor will be on-site with the restrict of detection of 136 pM, 141 pM and 129 pM for H1N1, H7N9 and H5N1, respectively. The imaging array additionally displayed good mismatch discrimination, wonderful anti-interference, and actual pattern utility. In view of its benefits of quick detection, low value and multiplexed evaluation, the imaging array is anticipated to have potential functions for early infectious illness analysis in resource-constrained settings.

MOF-enzyme hybrid nanosystem embellished 3D hole fiber membranes for in-situ blood separation and biosensing array

Modified metal-organic frameworks (MOFs) doping with enzymes exhibit excessive enzyme stability and catalytic efficiency, which is a analysis hotspot within the area of enzyme-based sensing. Though the MOF-enzyme constitutes a 3D construction within the nanoscale, the macroscopic meeting configuration nonetheless stays in 1D or 2D constructions, limiting sensing functions in direction of complicated organic targets. Herein, the MOF-enzyme hybrid nanosystem was assembled into 3D porous conductive helps through a controllable bodily embedding methodology, displaying excessive enzymatic loading, stability and cascade catalytic efficiency.

The modified MOFs combing with enzymes served as a sensing response system, and the conductive hole fiber membranes (HFMs) served as a purposeful platform. The multifunctional gadget integrates pumpless hydrodynamic transport, interconnected conductive polymer, and blood separation modules, displaying quick capillary fluid circulation, hint sampling (three μL), excessive selectivity and accuracy. The linear sensing vary was in 2-24 mM glucose, 0.05-6 mM lactic acid, and 0.1-10 mM ldl cholesterol, respectively, with sensitivities of 24.2, 150, 73.6 nA mM-1. Moreover, this technique of modular meeting of biosensing array can simply implement multiplex metabolites detection concurrently.

ukcte
ukcte

Human Kallikrein 11 (KLK11) ELISA Kit

RD-KLK11-Hu-96Tests 96 Tests
EUR 662

KLK11 antibody

70R-18161 50 ul
EUR 435
Description: Rabbit polyclonal KLK11 antibody

KLK11 antibody

70R-30723 100 ug
EUR 327
Description: Rabbit polyclonal KLK11 antibody

KLK11 antibody

70R-14168 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal KLK11 antibody

KLK11 Antibody

36576-100ul 100ul
EUR 252

KLK11 Antibody

1-CSB-PA990038
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK11. Recognizes KLK11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

KLK11 Antibody

1-CSB-PA562259
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK11. Recognizes KLK11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KLK11 antibody

70R-KR008 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal KLK11 antibody

KLK11 antibody

70R-51362 100 ul
EUR 244
Description: Purified Polyclonal KLK11 antibody

KLK11 Antibody

1-CSB-PA012448GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KLK11. Recognizes KLK11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

KLK11 Conjugated Antibody

C36576 100ul
EUR 397

Anti-KLK11 antibody

STJ28724 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed.

Anti-KLK11 antibody

STJ114439 100 µl
EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed.

KLK11 siRNA

20-abx921815
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KLK11 siRNA

20-abx921816
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Cleaved-KLK11 (I54) Antibody

1-CSB-PA000045
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-KLK11 (I54). Recognizes Cleaved-KLK11 (I54) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Kallikrein 11 (KLK11) Antibody

20-abx006376
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody

20-abx210855
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody

20-abx210239
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody

20-abx101221
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Kallikrein 11 (KLK11) Antibody

20-abx113305
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody

abx145911-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody

20-abx173222
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Kallikrein 11 (KLK11) Antibody

20-abx270254
  • EUR 467.00
  • EUR 537.00
  • EUR 272.00
  • EUR 815.00
  • EUR 356.00
  • 100 tests
  • 200 tests
  • 25 tests
  • 500 tests
  • 50 tests
  • Shipped within 5-7 working days.

Kallikrein 11 (KLK11) Antibody

20-abx323408
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hippostatin (KLK11) Polyclonal Antibody

ABP-PAB-24312 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

KLK11 Rabbit pAb

A12565-100ul 100 ul
EUR 308

KLK11 Rabbit pAb

A12565-200ul 200 ul
EUR 459

KLK11 Rabbit pAb

A12565-20ul 20 ul
EUR 183

KLK11 Rabbit pAb

A12565-50ul 50 ul
EUR 223

KLK11 cloning plasmid

CSB-CL880069HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atgaggattctgcagttaatcctgcttgctctggcaacagggcttgtagggggagagaccaggatcatcaaggggttcgagtgcaagcctcactcccagccctggcaggcagccctgttcgagaagacgcggctactctgtggggcgacgctcatcgcccccagatggctcctgac
  • Show more
Description: A cloning plasmid for the KLK11 gene.

KLK11 Rabbit pAb

A6641-100ul 100 ul
EUR 308

KLK11 Rabbit pAb

A6641-200ul 200 ul
EUR 459

KLK11 Rabbit pAb

A6641-20ul 20 ul
EUR 183

KLK11 Rabbit pAb

A6641-50ul 50 ul
EUR 223

Human Kallikrein-11 (KLK11) Antibody

32102-05111 150 ug
EUR 261

Cleaved-KLK11 (I54) Polyclonal Antibody

ABP50040-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-KLK11 I54) from Human. This Cleaved-KLK11 I54) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90

Cleaved-KLK11 (I54) Polyclonal Antibody

ABP50040-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-KLK11 I54) from Human. This Cleaved-KLK11 I54) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90

Cleaved-KLK11 (I54) Polyclonal Antibody

ABP50040-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of Cleaved-KLK11 I54) from Human. This Cleaved-KLK11 I54) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90

Cleaved-KLK11 (I54) Polyclonal Antibody

ES1039-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Cleaved-KLK11 (I54) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-KLK11 (I54) Polyclonal Antibody

ES1039-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Cleaved-KLK11 (I54) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-Kallikrein 11/KLK11 Antibody

PA1631 100ug/vial
EUR 334

Anti-Cleaved-KLK11 (I54) antibody

STJ90054 200 µl
EUR 197
Description: Rabbit polyclonal to Cleaved-KLK11 (I54).

KLK11 protein (His tag)

80R-3906 100 ug
EUR 327
Description: Purified recombinant KLK11 protein (His tag)

Human KLK11 ELISA Kit

EHK0079 96Tests
EUR 521

Bovine KLK11 ELISA Kit

EBK0079 96Tests
EUR 521

Canine KLK11 ELISA Kit

ECK0079 96Tests
EUR 521

Chicken KLK11 ELISA Kit

ECKK0079 96Tests
EUR 521

Anserini KLK11 ELISA Kit

EAK0079 96Tests
EUR 521

Goat KLK11 ELISA Kit

EGTK0079 96Tests
EUR 521

Mouse KLK11 shRNA Plasmid

20-abx974833
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human KLK11 shRNA Plasmid

20-abx957521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Porcine KLK11 ELISA Kit

EPK0079 96Tests
EUR 521

Sheep KLK11 ELISA Kit

ESK0079 96Tests
EUR 521

Rat KLK11 ELISA Kit

ERK0079 96Tests
EUR 521

Rabbit KLK11 ELISA Kit

ERTK0079 96Tests
EUR 521

Monkey KLK11 ELISA Kit

EMKK0079 96Tests
EUR 521

Recombinant Kallikrein 11 (KLK11)

4-RPA669Hu01
  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UBX7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.5kDa
  • Isoelectric Point: 8.8
Description: Recombinant Human Kallikrein 11 expressed in: E.coli

KLK11 Recombinant Protein (Human)

RP017227 100 ug Ask for price

KLK11 Recombinant Protein (Rat)

RP207389 100 ug Ask for price

KLK11 Recombinant Protein (Mouse)

RP146081 100 ug Ask for price

KLK11 Recombinant Protein (Mouse)

RP146084 100 ug Ask for price

Human Kallikrein-11 (KLK11) Antibody (Biotin Conjugate)

32102-05121 150 ug
EUR 369

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse)

4-PAA669Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11)

Human Kallikrein 11 (KLK11) Protein

20-abx067586
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human KLK11

EK5502 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK11 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KLK11 PicoKine ELISA Kit

EK1166 96 wells
EUR 425
Description: For quantitative detection of human KLK11 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

Guinea Pig KLK11 ELISA Kit

EGK0079 96Tests
EUR 521

Klk11 ORF Vector (Rat) (pORF)

ORF069131 1.0 ug DNA
EUR 506

KLK11 ORF Vector (Human) (pORF)

ORF005743 1.0 ug DNA
EUR 95

Klk11 ORF Vector (Mouse) (pORF)

ORF048695 1.0 ug DNA
EUR 506

Klk11 ORF Vector (Mouse) (pORF)

ORF048696 1.0 ug DNA
EUR 506

KLK11 ELISA Kit (Human) (OKBB00907)

OKBB00907 96 Wells
EUR 505
Description: Description of target: Kallikrein-11 is a protein that in humans is encoded by the KLK11 gene. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in two transcript variants encoding two different isoforms which are differentially expressed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

KLK11 ELISA Kit (Human) (OKCD06643)

OKCD06643 96 Wells
EUR 753
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL

KLK11 ELISA Kit (Mouse) (OKEH05783)

OKEH05783 96 Wells
EUR 662
Description: Description of target: Possible multifunctional protease. Efficiently cleaves 'bz-Phe-Arg-4-methylcoumaryl-7-amide', a kallikrein substrate, and weakly cleaves other substrates for kallikrein and trypsin.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

KLK11 ELISA Kit (Human) (OKEH03178)

OKEH03178 96 Wells
EUR 662
Description: Description of target: Possible multifunctional protease. Efficiently cleaves 'bz-Phe-Arg-4-methylcoumaryl-7-amide', a kallikrein substrate, and weakly cleaves other substrates for kallikrein and trypsin. Cleaves synthetic peptides after arginine but not lysine residues.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Human Kallikrein-11 (KLK11) AssayLite Antibody (FITC Conjugate)

32102-05141 150 ug
EUR 428

Human Kallikrein-11 (KLK11) AssayLite Antibody (RPE Conjugate)

32102-05151 150 ug
EUR 428

Human Kallikrein-11 (KLK11) AssayLite Antibody (APC Conjugate)

32102-05161 150 ug
EUR 428

Human Kallikrein-11 (KLK11) AssayLite Antibody (PerCP Conjugate)

32102-05171 150 ug
EUR 471

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), APC

4-PAA669Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with APC.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAA669Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with Biotin.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), Cy3

4-PAA669Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with Cy3.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), FITC

4-PAA669Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with FITC.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), HRP

4-PAA669Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with HRP.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), PE

4-PAA669Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with PE.

Human Kallikrein 11 (KLK11) ELISA Kit

20-abx152083
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human KLK11/ Kallikrein-11 ELISA Kit

E1387Hu 1 Kit
EUR 571

Mouse Kallikrein- 11, Klk11 ELISA KIT

ELI-02338m 96 Tests
EUR 865

Human Kallikrein- 11, KLK11 ELISA KIT

ELI-02339h 96 Tests
EUR 824

Human Kallikrein 11 (KLK11) ELISA Kit

abx570232-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Kallikrein 11 (KLK11) CLIA Kit

20-abx491852
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Kallikrein 11 (KLK11) ELISA Kit

abx513661-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Klk11 sgRNA CRISPR Lentivector set (Rat)

K6487601 3 x 1.0 ug
EUR 339

Klk11 sgRNA CRISPR Lentivector set (Mouse)

K3991601 3 x 1.0 ug
EUR 339

KLK11 sgRNA CRISPR Lentivector set (Human)

K1160501 3 x 1.0 ug
EUR 339

KLK11 Kallikrein-11 Human Recombinant Protein

PROTQ9UBX7 Regular: 20ug
EUR 317
Description: KLK11 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 226 amino acids (54-278 a.a) and having a molecular mass of 24.8kDa.

Human Kallikrein 11 (KLK11) ELISA Kit

SEA669Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit

SEA669Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit

SEA669Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit

SEA669Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit

4-SEA669Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Kallikrein 11 elisa. Alternative names of the recognized antigen: TLSP
  • hK11
  • Hippostatin
  • Kallikrein-Related Peptidase 11
  • Serine protease 20
  • Trypsin-like protease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 11 (KLK11) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Recombinant Human KLK11/Kallikrein-11 Protein

RP00149 5 μg
EUR 221

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAA669Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KLK11 (Ile39~Asn282)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with APC-Cy7.

Human Kallikrein-11 (KLK11) AssayMax ELISA Kit

EK1110-1 96 Well Plate
EUR 477

ELISA kit for Human KLK11 (Kallikrein 11)

ELK2094 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 11 (KLK11). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
  • Show more
Description: A sandwich ELISA kit for detection of Kallikrein 11 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Recombinant Human Kallikrein 11/KLK11 (C-6His)

C361-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Recombinant Human Kallikrein 11/KLK11 (C-6His)

C361-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Recombinant Human Kallikrein 11/KLK11 (C-6His)

C361-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Recombinant Human Kallikrein 11/KLK11 (C-6His)

C361-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Klk11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6487602 1.0 ug DNA
EUR 154

Klk11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6487603 1.0 ug DNA
EUR 154

Klk11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6487604 1.0 ug DNA
EUR 154

Klk11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3991602 1.0 ug DNA
EUR 154

Klk11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3991603 1.0 ug DNA
EUR 154

Klk11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3991604 1.0 ug DNA
EUR 154

KLK11 sgRNA CRISPR Lentivector (Human) (Target 1)

K1160502 1.0 ug DNA
EUR 154

KLK11 sgRNA CRISPR Lentivector (Human) (Target 2)

K1160503 1.0 ug DNA
EUR 154

KLK11 sgRNA CRISPR Lentivector (Human) (Target 3)

K1160504 1.0 ug DNA
EUR 154

ELISA kit for Human Kallikrein 11 (KLK11)

KTE61901-48T 48T
EUR 354
  • Kallikrein 11 is a member of the human kallikrein gene family. KLK11 is a secreted serine protease, highly expressed in hormonally regulated tissues, including the prostate and the ovary. KLK11 has two alternative splicing isoforms, known as the brai
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein 11 (KLK11) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein 11 (KLK11)

KTE61901-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Kallikrein 11 is a member of the human kallikrein gene family. KLK11 is a secreted serine protease, highly expressed in hormonally regulated tissues, including the prostate and the ovary. KLK11 has two alternative splicing isoforms, known as the brai
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein 11 (KLK11) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein 11 (KLK11)

KTE61901-96T 96T
EUR 572
  • Kallikrein 11 is a member of the human kallikrein gene family. KLK11 is a secreted serine protease, highly expressed in hormonally regulated tissues, including the prostate and the ovary. KLK11 has two alternative splicing isoforms, known as the brai
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein 11 (KLK11) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

KLK11 Protein Vector (Human) (pPB-C-His)

PV022969 500 ng
EUR 329

KLK11 Protein Vector (Human) (pPB-N-His)

PV022970 500 ng
EUR 329

KLK11 Protein Vector (Human) (pPM-C-HA)

PV022971 500 ng
EUR 329

KLK11 Protein Vector (Human) (pPM-C-His)

PV022972 500 ng
EUR 329

KLK11 Protein Vector (Rat) (pPB-C-His)

PV276522 500 ng
EUR 603

Round dichroism enhancement and dynamically adjustment in planar steel chiral break up rings with graphene sheets arrays

Chiral plasmonic nanostructures have grow to be a promising platform for polarization converters and molecular evaluation. Nonetheless, the round dichroism (CD) of planar chiral plasmonic nanostructures is all the time weak and troublesome for dynamic adjustment. On this work, graphene sheets (GSs) are launched in planar steel chiral break up rings (MCSRs) to boost and dynamically regulate their CD impact. The chiral break up rings encompass rotated massive and small break up rings. Simulation outcomes present that the plasmonic coupling between MCSRs and GSs can improve the absorption and CD spectra of MCSRs at two resonant wavelengths.

The floor present distributions reveal that the CD alerts are as a result of localized floor plasmon resonances on the large and small break up rings, respectively. The loss distributions illustrate that the elevated loss primarily locates in GSs. As well as, the CD spectra of MCSRs/GSs will be dynamically adjusted by the Fermi power of GSs, and strongly depends upon the geometric parameters of MCSRs and the setting mediums, which can be utilized to detect the setting temperature and focus. The outcomes assist to design dynamically adjustable chiral nanostructures and promote their functions in setting detection.

64 PI/PDMS hybrid cantilever arrays with an built-in pressure sensor for a high-throughput drug toxicity screening utility

Herein, we suggest a novel biosensing platform involving an array of 64 hybrid cantilevers and built-in pressure sensors to measure the real-time contractility of the drug-treated cardiomyocytes (CMs). The pressure sensor is built-in on the polyimide (PI) cantilever. To enhance the pressure sensor reliability and assemble the engineered cardiac tissue, the nanogroove-patterned polydimethylsiloxane (PDMS) encapsulation layer is bonded on the PI cantilever. The preliminary sensing traits display the superior structural integrity, robustness, enhanced sensitivity, and repeatability of the proposed units.

The long-term sturdiness and biocompatibility of the PI/PDMS hybrid cantilever is verified by evaluating the cell viability and contractility. We additionally validate the proposed biosensing platform for cardiotoxicity measurement by making use of it to 2 particular cardiovascular medicine: quinidine and verapamil. In response to quinidine and verapamil, the engineered CMs exhibited damaging inotropic and chronotropic results. The fabricated cantilever gadget efficiently detected the quinidine-induced antagonistic results in CMs comparable to early after depolarization (EADs) and Torsade de factors (TdP) in real-time. The array of hybrid cantilevers with built-in pressure sensors has the potential to fulfill the necessity for modern analytic platforms owing to its excessive throughput and simplified information evaluation.

Tapered Coaxial Arrays for Photon- and Plasmon-Enhanced Mild Harvesting in Perovskite Photo voltaic Cells: A Theoretical Investigation Utilizing the Finite Ingredient Methodology

Though there have been stories of separate research of photon-enhanced and plasmon-enhanced gentle harvesting to enhance perovskite photo voltaic cell (PSC) effectivity, there are none which have achieved simultaneous enhancement in each photonic and plasmonic results in PSCs. On this work, we designed a layer of tapered coaxial humps (TCHs) to reap each in PSCs. The sunshine absorption conduct of the textured perovskite layer in PSCs was systematically investigated via the finite aspect methodology (FEM). The calculation outcomes present that the TCH-textured perovskite layer absorbs 67.6 % of seen gentle beneath AM 1.5G photo voltaic irradiation, a 21.8 % enhance relative to the planar reference cell with out TCHs.

Utilizing this design, a perovskite thickness of solely 106 nm is required to appreciate the total gentle absorption that usually requires 300-nm-thick perovskite with out TCHs. To disclose the mechanism of sunshine absorption enhancement, the particular area distributions had been studied. We demonstrated that completely different photonic modes and plasmonic modes collectively lead to outstanding gentle absorption enhancement within the 500-800 nm wavelength vary. The textured PSCs reported herein present an efficient methodology to lower Pb-based perovskite consumption and understand angle-insensitive and ultrathin PSCs.

Leave a Reply

Your email address will not be published. Required fields are marked *