One-step quick and label-free imaging array for multiplexed detection of hint avian influenza viruses

Fast and low-cost analysis of a number of infectious illnesses is of nice significance particularly in densely populated or resource-constrained settings. Herein, we developed a one-step quick and label-free imaging array for multiplexed detection of hint avian influenza virus (AIV) DNA biomarkers. By designing a sequence of particular and environment friendly catalytic hairpin meeting (CHA) amplification reactions and using thioflavin T, a selected G-quadruplex fluorescence probe, three subtypes of AIV DNA biomarkers (H1N1, H7N9 and H5N1) had been concurrently and shortly detected inside solely 20 min, which simply wanted a small reagent quantity of 50 μL and a smartphone as a substitute of a spectrometer.

With the mixture of fluorescence imaging output and grey-level evaluation, the array sensor will be on-site with the restrict of detection of 136 pM, 141 pM and 129 pM for H1N1, H7N9 and H5N1, respectively. The imaging array additionally displayed good mismatch discrimination, wonderful anti-interference, and actual pattern utility. In view of its benefits of quick detection, low value and multiplexed evaluation, the imaging array is anticipated to have potential functions for early infectious illness analysis in resource-constrained settings.

MOF-enzyme hybrid nanosystem embellished 3D hole fiber membranes for in-situ blood separation and biosensing array

Modified metal-organic frameworks (MOFs) doping with enzymes exhibit excessive enzyme stability and catalytic efficiency, which is a analysis hotspot within the area of enzyme-based sensing. Though the MOF-enzyme constitutes a 3D construction within the nanoscale, the macroscopic meeting configuration nonetheless stays in 1D or 2D constructions, limiting sensing functions in direction of complicated organic targets. Herein, the MOF-enzyme hybrid nanosystem was assembled into 3D porous conductive helps through a controllable bodily embedding methodology, displaying excessive enzymatic loading, stability and cascade catalytic efficiency.

The modified MOFs combing with enzymes served as a sensing response system, and the conductive hole fiber membranes (HFMs) served as a purposeful platform. The multifunctional gadget integrates pumpless hydrodynamic transport, interconnected conductive polymer, and blood separation modules, displaying quick capillary fluid circulation, hint sampling (three μL), excessive selectivity and accuracy. The linear sensing vary was in 2-24 mM glucose, 0.05-6 mM lactic acid, and 0.1-10 mM ldl cholesterol, respectively, with sensitivities of 24.2, 150, 73.6 nA mM^-1. Moreover, this technique of modular meeting of biosensing array can simply implement multiplex metabolites detection concurrently.

Human Kallikrein 11 (KLK11) ELISA Kit
RD-KLK11-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

KLK11 antibody
70R-18161	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KLK11 antibody

KLK11 antibody
70R-30723	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal KLK11 antibody

KLK11 antibody
70R-14168	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal KLK11 antibody

KLK11 Antibody
36576-100ul	SAB	100ul	EUR 252

KLK11 Antibody
1-CSB-PA990038	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK11. Recognizes KLK11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

KLK11 Antibody
1-CSB-PA562259	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK11. Recognizes KLK11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KLK11 antibody
70R-KR008	Fitzgerald	100 ug	EUR 300
Description: Affinity purified Rabbit polyclonal KLK11 antibody

KLK11 antibody
70R-51362	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal KLK11 antibody

KLK11 Antibody
1-CSB-PA012448GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KLK11. Recognizes KLK11 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

KLK11 Conjugated Antibody
C36576	SAB	100ul	EUR 397

Anti-KLK11 antibody
STJ28724	St John's Laboratory	100 µl	EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed.

Anti-KLK11 antibody
STJ114439	St John's Laboratory	100 µl	EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed.

KLK11 siRNA
20-abx921815	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KLK11 siRNA
20-abx921816	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Cleaved-KLK11 (I54) Antibody
1-CSB-PA000045	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-KLK11 (I54). Recognizes Cleaved-KLK11 (I54) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Kallikrein 11 (KLK11) Antibody
20-abx006376	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody
20-abx210855	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody
20-abx210239	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody
20-abx101221	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kallikrein 11 (KLK11) Antibody
20-abx113305	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody
abx145911-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Kallikrein 11 (KLK11) Antibody
20-abx173222	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Kallikrein 11 (KLK11) Antibody
20-abx270254	Abbexa	EUR 467.00 EUR 537.00 EUR 272.00 EUR 815.00 EUR 356.00	100 tests 200 tests 25 tests 500 tests 50 tests
Shipped within 5-7 working days.

Kallikrein 11 (KLK11) Antibody
20-abx323408	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Hippostatin (KLK11) Polyclonal Antibody
ABP-PAB-24312	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

KLK11 Rabbit pAb
A12565-100ul	Abclonal	100 ul	EUR 308

KLK11 Rabbit pAb
A12565-200ul	Abclonal	200 ul	EUR 459

KLK11 Rabbit pAb
A12565-20ul	Abclonal	20 ul	EUR 183

KLK11 Rabbit pAb
A12565-50ul	Abclonal	50 ul	EUR 223

KLK11 cloning plasmid
CSB-CL880069HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 753 Sequence: atgaggattctgcagttaatcctgcttgctctggcaacagggcttgtagggggagagaccaggatcatcaaggggttcgagtgcaagcctcactcccagccctggcaggcagccctgttcgagaagacgcggctactctgtggggcgacgctcatcgcccccagatggctcctgac Show more
Description: A cloning plasmid for the KLK11 gene.

KLK11 Rabbit pAb
A6641-100ul	Abclonal	100 ul	EUR 308

KLK11 Rabbit pAb
A6641-200ul	Abclonal	200 ul	EUR 459

KLK11 Rabbit pAb
A6641-20ul	Abclonal	20 ul	EUR 183

KLK11 Rabbit pAb
A6641-50ul	Abclonal	50 ul	EUR 223

Human Kallikrein-11 (KLK11) Antibody
32102-05111	AssayPro	150 ug	EUR 261

Cleaved-KLK11 (I54) Polyclonal Antibody
ABP50040-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90 Applications tips:
Description: A polyclonal antibody for detection of Cleaved-KLK11 I54) from Human. This Cleaved-KLK11 I54) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90

Cleaved-KLK11 (I54) Polyclonal Antibody
ABP50040-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90 Applications tips:
Description: A polyclonal antibody for detection of Cleaved-KLK11 I54) from Human. This Cleaved-KLK11 I54) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90

Cleaved-KLK11 (I54) Polyclonal Antibody
ABP50040-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90 Applications tips:
Description: A polyclonal antibody for detection of Cleaved-KLK11 I54) from Human. This Cleaved-KLK11 I54) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human KLK11 at AA range: 10-90

Cleaved-KLK11 (I54) Polyclonal Antibody
ES1039-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Cleaved-KLK11 (I54) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Cleaved-KLK11 (I54) Polyclonal Antibody
ES1039-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Cleaved-KLK11 (I54) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-Kallikrein 11/KLK11 Antibody
PA1631	BosterBio	100ug/vial	EUR 334

Anti-Cleaved-KLK11 (I54) antibody
STJ90054	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Cleaved-KLK11 (I54).

KLK11 protein (His tag)
80R-3906	Fitzgerald	100 ug	EUR 327
Description: Purified recombinant KLK11 protein (His tag)

Human KLK11 ELISA Kit
EHK0079	Abclonal	96Tests	EUR 521

Bovine KLK11 ELISA Kit
EBK0079	Abclonal	96Tests	EUR 521

Canine KLK11 ELISA Kit
ECK0079	Abclonal	96Tests	EUR 521

Chicken KLK11 ELISA Kit
ECKK0079	Abclonal	96Tests	EUR 521

Anserini KLK11 ELISA Kit
EAK0079	Abclonal	96Tests	EUR 521

Goat KLK11 ELISA Kit
EGTK0079	Abclonal	96Tests	EUR 521

Mouse KLK11 shRNA Plasmid
20-abx974833	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human KLK11 shRNA Plasmid
20-abx957521	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine KLK11 ELISA Kit
EPK0079	Abclonal	96Tests	EUR 521

Sheep KLK11 ELISA Kit
ESK0079	Abclonal	96Tests	EUR 521

Rat KLK11 ELISA Kit
ERK0079	Abclonal	96Tests	EUR 521

Rabbit KLK11 ELISA Kit
ERTK0079	Abclonal	96Tests	EUR 521

Monkey KLK11 ELISA Kit
EMKK0079	Abclonal	96Tests	EUR 521

Recombinant Kallikrein 11 (KLK11)
4-RPA669Hu01	Cloud-Clone	EUR 481.70 EUR 232.00 EUR 1531.36 EUR 577.12 EUR 1054.24 EUR 385.00 EUR 3678.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UBX7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.5kDa Isoelectric Point: 8.8
Description: Recombinant Human Kallikrein 11 expressed in: E.coli

KLK11 Recombinant Protein (Human)
RP017227	ABM	100 ug	Ask for price

KLK11 Recombinant Protein (Rat)
RP207389	ABM	100 ug	Ask for price

KLK11 Recombinant Protein (Mouse)
RP146081	ABM	100 ug	Ask for price

KLK11 Recombinant Protein (Mouse)
RP146084	ABM	100 ug	Ask for price

Human Kallikrein-11 (KLK11) Antibody (Biotin Conjugate)
32102-05121	AssayPro	150 ug	EUR 369

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse)
4-PAA669Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11)

Human Kallikrein 11 (KLK11) Protein
20-abx067586	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Human KLK11
EK5502	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK11 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KLK11 PicoKine ELISA Kit
EK1166	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human KLK11 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

Guinea Pig KLK11 ELISA Kit
EGK0079	Abclonal	96Tests	EUR 521

Klk11 ORF Vector (Rat) (pORF)
ORF069131	ABM	1.0 ug DNA	EUR 506

KLK11 ORF Vector (Human) (pORF)
ORF005743	ABM	1.0 ug DNA	EUR 95

Klk11 ORF Vector (Mouse) (pORF)
ORF048695	ABM	1.0 ug DNA	EUR 506

Klk11 ORF Vector (Mouse) (pORF)
ORF048696	ABM	1.0 ug DNA	EUR 506

KLK11 ELISA Kit (Human) (OKBB00907)
OKBB00907	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Kallikrein-11 is a protein that in humans is encoded by the KLK11 gene. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing of this gene results in two transcript variants encoding two different isoforms which are differentially expressed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

KLK11 ELISA Kit (Human) (OKCD06643)
OKCD06643	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Alternate splicing and the use of alternate promoters results in multiple transcript variants encoding distinct isoforms which are differentially expressed.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.053ng/mL

KLK11 ELISA Kit (Mouse) (OKEH05783)
OKEH05783	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Possible multifunctional protease. Efficiently cleaves 'bz-Phe-Arg-4-methylcoumaryl-7-amide', a kallikrein substrate, and weakly cleaves other substrates for kallikrein and trypsin.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

KLK11 ELISA Kit (Human) (OKEH03178)
OKEH03178	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Possible multifunctional protease. Efficiently cleaves 'bz-Phe-Arg-4-methylcoumaryl-7-amide', a kallikrein substrate, and weakly cleaves other substrates for kallikrein and trypsin. Cleaves synthetic peptides after arginine but not lysine residues.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Human Kallikrein-11 (KLK11) AssayLite Antibody (FITC Conjugate)
32102-05141	AssayPro	150 ug	EUR 428

Human Kallikrein-11 (KLK11) AssayLite Antibody (RPE Conjugate)
32102-05151	AssayPro	150 ug	EUR 428

Human Kallikrein-11 (KLK11) AssayLite Antibody (APC Conjugate)
32102-05161	AssayPro	150 ug	EUR 428

Human Kallikrein-11 (KLK11) AssayLite Antibody (PerCP Conjugate)
32102-05171	AssayPro	150 ug	EUR 471

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), APC
4-PAA669Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with APC.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA669Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with Biotin.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA669Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with Cy3.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), FITC
4-PAA669Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with FITC.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), HRP
4-PAA669Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with HRP.

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), PE
4-PAA669Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with PE.

Human Kallikrein 11 (KLK11) ELISA Kit
20-abx152083	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human KLK11/ Kallikrein-11 ELISA Kit
E1387Hu	Sunlong	1 Kit	EUR 571

Mouse Kallikrein- 11, Klk11 ELISA KIT
ELI-02338m	Lifescience Market	96 Tests	EUR 865

Human Kallikrein- 11, KLK11 ELISA KIT
ELI-02339h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 11 (KLK11) ELISA Kit
abx570232-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kallikrein 11 (KLK11) CLIA Kit
20-abx491852	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Kallikrein 11 (KLK11) ELISA Kit
abx513661-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Klk11 sgRNA CRISPR Lentivector set (Rat)
K6487601	ABM	3 x 1.0 ug	EUR 339

Klk11 sgRNA CRISPR Lentivector set (Mouse)
K3991601	ABM	3 x 1.0 ug	EUR 339

KLK11 sgRNA CRISPR Lentivector set (Human)
K1160501	ABM	3 x 1.0 ug	EUR 339

KLK11 Kallikrein-11 Human Recombinant Protein
PROTQ9UBX7	BosterBio	Regular: 20ug	EUR 317
Description: KLK11 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 226 amino acids (54-278 a.a) and having a molecular mass of 24.8kDa.

Human Kallikrein 11 (KLK11) ELISA Kit
SEA669Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit
SEA669Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit
SEA669Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit
SEA669Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 11 (KLK11) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 11 (KLK11) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 11 (KLK11) ELISA Kit
4-SEA669Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 11 elisa. Alternative names of the recognized antigen: TLSP hK11 Hippostatin Kallikrein-Related Peptidase 11 Serine protease 20 Trypsin-like protease
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 11 (KLK11) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Recombinant Human KLK11/Kallikrein-11 Protein
RP00149	Abclonal	5 μg	EUR 221

Kallikrein 11 (KLK11) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA669Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK11 (Ile39~Asn282) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Kallikrein 11 (KLK11). This antibody is labeled with APC-Cy7.

Human Kallikrein-11 (KLK11) AssayMax ELISA Kit
EK1110-1	AssayPro	96 Well Plate	EUR 477

ELISA kit for Human KLK11 (Kallikrein 11)
ELK2094	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 11 (KLK11). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1 Show more
Description: A sandwich ELISA kit for detection of Kallikrein 11 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Recombinant Human Kallikrein 11/KLK11 (C-6His)
C361-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Recombinant Human Kallikrein 11/KLK11 (C-6His)
C361-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Recombinant Human Kallikrein 11/KLK11 (C-6His)
C361-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Recombinant Human Kallikrein 11/KLK11 (C-6His)
C361-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, 2mM CaCl2, pH 8.0.

Klk11 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6487602	ABM	1.0 ug DNA	EUR 154

Klk11 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6487603	ABM	1.0 ug DNA	EUR 154

Klk11 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6487604	ABM	1.0 ug DNA	EUR 154

Klk11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3991602	ABM	1.0 ug DNA	EUR 154

Klk11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3991603	ABM	1.0 ug DNA	EUR 154

Klk11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3991604	ABM	1.0 ug DNA	EUR 154

KLK11 sgRNA CRISPR Lentivector (Human) (Target 1)
K1160502	ABM	1.0 ug DNA	EUR 154

KLK11 sgRNA CRISPR Lentivector (Human) (Target 2)
K1160503	ABM	1.0 ug DNA	EUR 154

KLK11 sgRNA CRISPR Lentivector (Human) (Target 3)
K1160504	ABM	1.0 ug DNA	EUR 154

ELISA kit for Human Kallikrein 11 (KLK11)
KTE61901-48T	Abbkine	48T	EUR 354
Kallikrein 11 is a member of the human kallikrein gene family. KLK11 is a secreted serine protease, highly expressed in hormonally regulated tissues, including the prostate and the ovary. KLK11 has two alternative splicing isoforms, known as the brai Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein 11 (KLK11) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein 11 (KLK11)
KTE61901-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Kallikrein 11 is a member of the human kallikrein gene family. KLK11 is a secreted serine protease, highly expressed in hormonally regulated tissues, including the prostate and the ovary. KLK11 has two alternative splicing isoforms, known as the brai Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein 11 (KLK11) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein 11 (KLK11)
KTE61901-96T	Abbkine	96T	EUR 572
Kallikrein 11 is a member of the human kallikrein gene family. KLK11 is a secreted serine protease, highly expressed in hormonally regulated tissues, including the prostate and the ovary. KLK11 has two alternative splicing isoforms, known as the brai Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein 11 (KLK11) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

KLK11 Protein Vector (Human) (pPB-C-His)
PV022969	ABM	500 ng	EUR 329

KLK11 Protein Vector (Human) (pPB-N-His)
PV022970	ABM	500 ng	EUR 329

KLK11 Protein Vector (Human) (pPM-C-HA)
PV022971	ABM	500 ng	EUR 329

KLK11 Protein Vector (Human) (pPM-C-His)
PV022972	ABM	500 ng	EUR 329

KLK11 Protein Vector (Rat) (pPB-C-His)
PV276522	ABM	500 ng	EUR 603

Round dichroism enhancement and dynamically adjustment in planar steel chiral break up rings with graphene sheets arrays

Chiral plasmonic nanostructures have grow to be a promising platform for polarization converters and molecular evaluation. Nonetheless, the round dichroism (CD) of planar chiral plasmonic nanostructures is all the time weak and troublesome for dynamic adjustment. On this work, graphene sheets (GSs) are launched in planar steel chiral break up rings (MCSRs) to boost and dynamically regulate their CD impact. The chiral break up rings encompass rotated massive and small break up rings. Simulation outcomes present that the plasmonic coupling between MCSRs and GSs can improve the absorption and CD spectra of MCSRs at two resonant wavelengths.

The floor present distributions reveal that the CD alerts are as a result of localized floor plasmon resonances on the large and small break up rings, respectively. The loss distributions illustrate that the elevated loss primarily locates in GSs. As well as, the CD spectra of MCSRs/GSs will be dynamically adjusted by the Fermi power of GSs, and strongly depends upon the geometric parameters of MCSRs and the setting mediums, which can be utilized to detect the setting temperature and focus. The outcomes assist to design dynamically adjustable chiral nanostructures and promote their functions in setting detection.

64 PI/PDMS hybrid cantilever arrays with an built-in pressure sensor for a high-throughput drug toxicity screening utility

Herein, we suggest a novel biosensing platform involving an array of 64 hybrid cantilevers and built-in pressure sensors to measure the real-time contractility of the drug-treated cardiomyocytes (CMs). The pressure sensor is built-in on the polyimide (PI) cantilever. To enhance the pressure sensor reliability and assemble the engineered cardiac tissue, the nanogroove-patterned polydimethylsiloxane (PDMS) encapsulation layer is bonded on the PI cantilever. The preliminary sensing traits display the superior structural integrity, robustness, enhanced sensitivity, and repeatability of the proposed units.

The long-term sturdiness and biocompatibility of the PI/PDMS hybrid cantilever is verified by evaluating the cell viability and contractility. We additionally validate the proposed biosensing platform for cardiotoxicity measurement by making use of it to 2 particular cardiovascular medicine: quinidine and verapamil. In response to quinidine and verapamil, the engineered CMs exhibited damaging inotropic and chronotropic results. The fabricated cantilever gadget efficiently detected the quinidine-induced antagonistic results in CMs comparable to early after depolarization (EADs) and Torsade de factors (TdP) in real-time. The array of hybrid cantilevers with built-in pressure sensors has the potential to fulfill the necessity for modern analytic platforms owing to its excessive throughput and simplified information evaluation.

Tapered Coaxial Arrays for Photon- and Plasmon-Enhanced Mild Harvesting in Perovskite Photo voltaic Cells: A Theoretical Investigation Utilizing the Finite Ingredient Methodology

Though there have been stories of separate research of photon-enhanced and plasmon-enhanced gentle harvesting to enhance perovskite photo voltaic cell (PSC) effectivity, there are none which have achieved simultaneous enhancement in each photonic and plasmonic results in PSCs. On this work, we designed a layer of tapered coaxial humps (TCHs) to reap each in PSCs. The sunshine absorption conduct of the textured perovskite layer in PSCs was systematically investigated via the finite aspect methodology (FEM). The calculation outcomes present that the TCH-textured perovskite layer absorbs 67.6 % of seen gentle beneath AM 1.5G photo voltaic irradiation, a 21.8 % enhance relative to the planar reference cell with out TCHs.

Utilizing this design, a perovskite thickness of solely 106 nm is required to appreciate the total gentle absorption that usually requires 300-nm-thick perovskite with out TCHs. To disclose the mechanism of sunshine absorption enhancement, the particular area distributions had been studied. We demonstrated that completely different photonic modes and plasmonic modes collectively lead to outstanding gentle absorption enhancement within the 500-800 nm wavelength vary. The textured PSCs reported herein present an efficient methodology to lower Pb-based perovskite consumption and understand angle-insensitive and ultrathin PSCs.