ukcte

Mixture of Antibody Arrays to Functionally Characterize Darkish Proteins in Human Olfactory Neuroepithelial Cells

The completion and annotation of the human proteome require the provision of knowledge associated to protein perform. Presently, greater than 1800 human genes represent the “darkish proteome,” which embody lacking proteins, uncharacterized human genes validated at protein degree, smORFs, proteins from lncRNAs, or any uncharacterized transcripts. Over the past years, totally different experimental workflows primarily based on multi-omics analyses, bioinformatics, and in vitro and in vivo research have been promoted by the Human Proteome Challenge Consortium to boost the annotation of darkish proteins.

On this chapter, we describe a technique that makes use of recombinant proteins and antibody arrays to ascertain an easy methodology in an effort to quickly characterize potential practical options of darkish proteins related to intracellular signaling dynamics and extracellular immune response in human cell cultures. Additional validating the strategy, this workflow was utilized to probe adjustments within the activation patterns of kinases and transcription components in addition to in cytokine manufacturing modulated by the darkish C1orf128 (PITHD1) protein in human olfactory neuroepithelial cells.

Identification of Antibody Biomarker Utilizing Excessive-Density Nucleic Acid Programmable Protein Array

A novel protein microarray expertise, known as high-density nucleic acid programmable protein array (HD-NAPPA), allows the serological screening of hundreds of proteins at one time. HD-NAPPA extends the capabilities of NAPPA, which produces protein microarrays on a standard glass microscope slide. By comparability, HD-NAPPA shows proteins in over 10,000 nanowells etched in a silicon slide.

Proteins on HD-NAPPA are expressed within the particular person remoted nanowells, through in vitro transcription and translation (IVTT), with none diffusion throughout incubation. Right here we describe the strategy for antibody biomarker identification utilizing HD-NAPPA, together with 4 major steps: (1) HD-NAPPA array protein expression, (2) main antibodies (serum/plasma) probing, (3) secondary antibody visualization, and (4) picture scanning and information processing.

ukcte
ukcte
SUFU Antibody
1-CSB-PA891560ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SUFU. Recognizes SUFU from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
SUFU Antibody
DF7687 200ul
EUR 304
Description: SUFU Antibody detects endogenous levels of total SUFU.
SUFU Antibody
1-CSB-PA022923GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUFU. Recognizes SUFU from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
SUFU Antibody
ABD7687 100 ug
EUR 438
SUFU Antibody
ABD7828 100 ug
EUR 438
Anti-SUFU Antibody
A02279-1 100ug/vial
EUR 294
SUFU Conjugated Antibody
C35993 100ul
EUR 397
SUFU Conjugated Antibody
C39155 100ul
EUR 397
SUFU (pS342) Antibody
20-abx000504
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
anti- SUFU antibody
FNab08373 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: suppressor of fused homolog (Drosophila)
  • Uniprot ID: Q9UMX1
  • Gene ID: 51684
  • Research Area: Cancer, Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against SUFU
Anti-SUFU antibody
PAab08373 100 ug
EUR 386
Anti-SUFU antibody
STJ11100632 50 µl
EUR 287
Description: The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.
Anti-SUFU antibody
STJ28840 100 µl
EUR 277
Description: The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.
Anti-SUFU antibody
STJ115390 100 µl
EUR 277
Description: The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.
SUFU Negative Regulator of Hedgehog Signaling (SUFU) Antibody
20-abx005181
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
SUFU Negative Regulator Of Hedgehog Signaling (SUFU) Antibody
20-abx211712
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SUFU Negative Regulator of Hedgehog Signaling (SUFU) Antibody
20-abx127058
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
SUFU Negative Regulator of Hedgehog Signaling (SUFU) Antibody
abx145714-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
SUFU Negative Regulator of Hedgehog Signaling (SUFU) Antibody
20-abx141906
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
SUFU Negative Regulator of Hedgehog Signaling (SUFU) Antibody
abx238373-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SUFU Negative Regulator of Hedgehog Signaling (SUFU) Antibody
20-abx322260
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SUFU siRNA
20-abx935622
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUFU siRNA
20-abx935623
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Sufu (Phospho-Ser342) Antibody
11552-100ul 100ul
EUR 252
Sufu (Phospho-Ser342) Antibody
11552-50ul 50ul
EUR 187
Phospho-SUFU (Ser342) Antibody
CSB-PA229368-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-SUFU (Ser342). Recognizes Phospho-SUFU (Ser342) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
Phospho-SUFU (Ser342) Antibody
CSB-PA229368-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against Phospho-SUFU (Ser342). Recognizes Phospho-SUFU (Ser342) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
SUFU Negative Regulator Of Hedgehog Signaling (SUFU) Protein
20-abx261500
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
SUFU Rabbit pAb
A13429-100ul 100 ul
EUR 308
SUFU Rabbit pAb
A13429-200ul 200 ul
EUR 459
SUFU Rabbit pAb
A13429-20ul 20 ul
EUR 183
SUFU Rabbit pAb
A13429-50ul 50 ul
EUR 223
SUFU cloning plasmid
CSB-CL891560HU-10ug 10ug
EUR 517
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1455
  • Sequence: atggcggagctgcggcctagcggcgcccccggccccaccgcgcccccggcccctggcccgactgcccccccggccttcgcttcgctctttcccccgggactgcacgccatctacggagagtgccgccgcctttaccctgaccagccgaacccgctccaggttaccgctatcgtca
  • Show more
Description: A cloning plasmid for the SUFU gene.
SUFU Blocking Peptide
DF7687-BP 1mg
EUR 195
SUFU Rabbit pAb
A6757-100ul 100 ul
EUR 308
SUFU Rabbit pAb
A6757-200ul 200 ul
EUR 459
SUFU Rabbit pAb
A6757-20ul 20 ul
EUR 183
SUFU Rabbit pAb
A6757-50ul 50 ul
EUR 223
SUFU Rabbit pAb
A19438-100ul 100 ul Ask for price
SUFU Rabbit pAb
A19438-200ul 200 ul Ask for price
SUFU Rabbit pAb
A19438-20ul 20 ul Ask for price
SUFU Rabbit pAb
A19438-50ul 50 ul
EUR 308
SUFU Negative Regulator Of Hedgehog Signaling Phospho-Ser342 (SUFU pS342) Antibody
abx332917-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.
Polyclonal SUFU Antibody (C-term)
APR04889G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUFU (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal SUFU antibody - middle region
APR00655G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUFU - middle region. This antibody is tested and proven to work in the following applications:
Polyclonal SUFU antibody - middle region
APR00749G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUFU - middle region. This antibody is tested and proven to work in the following applications:
Monoclonal SUFU Antibody, Clone: 1783CT536.263.29
AMM02579G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SUFU. The antibodies are raised in Mouse and are from clone 1783CT536.263.29. This antibody is applicable in WB, E
Anti-Phospho-SUFU-(S342) antibody
STJ22424 100 µl
EUR 393
Description: The Hedgehog signaling pathway plays an important role in early human development. The pathway is a signaling cascade that plays a role in pattern formation and cellular proliferation during development. This gene encodes a negative regulator of the hedgehog signaling pathway. Defects in this gene are a cause of medulloblastoma. Alternative splicing results in multiple transcript variants.
Human SUFU Negative Regulator Of Hedgehog Signaling (SUFU) ELISA Kit
abx383558-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SUFU protein (His tag)
80R-1977 100 ug
EUR 322
Description: Recombinant human SUFU protein (His tag)
SUFU ELISA KIT|Human
EF003347 96 Tests
EUR 689
Mouse SUFU shRNA Plasmid
20-abx973629
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human SUFU shRNA Plasmid
20-abx959898
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SUFU Recombinant Protein (Rat)
RP231659 100 ug Ask for price
SUFU Recombinant Protein (Human)
RP030583 100 ug Ask for price
SUFU Recombinant Protein (Mouse)
RP176351 100 ug Ask for price
SUFU Recombinant Protein (Mouse)
RP176354 100 ug Ask for price
Polyclonal SUFU antibody - N-terminal region
APR00623G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUFU - N-terminal region. This antibody is tested and proven to work in the following applications:
Sufu (Phospho-Ser342) Polyclonal Conjugated Antibody
C11552 100ul
EUR 397
Monoclonal SUFU Antibody (monoclonal) (M01), Clone: 1B2
AMM04155G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SUFU (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1B2. This antibody is applicable in E
Phospho-SUFU-S342 Rabbit pAb
AP0457-100ul 100 ul
EUR 384
Phospho-SUFU-S342 Rabbit pAb
AP0457-200ul 200 ul
EUR 554
Phospho-SUFU-S342 Rabbit pAb
AP0457-20ul 20 ul Ask for price
Phospho-SUFU-S342 Rabbit pAb
AP0457-50ul 50 ul
EUR 265
Sufu ORF Vector (Rat) (pORF)
ORF077221 1.0 ug DNA
EUR 506
SUFU ORF Vector (Human) (pORF)
ORF010195 1.0 ug DNA
EUR 95
Sufu ORF Vector (Mouse) (pORF)
ORF058785 1.0 ug DNA
EUR 506
Sufu ORF Vector (Mouse) (pORF)
ORF058786 1.0 ug DNA
EUR 506
Rabbit Anti-Human SUFU Polyclonal Antibody, Phospho-Ser342
CPB-869RH 100 ul
EUR 559
Sufu sgRNA CRISPR Lentivector set (Rat)
K7545701 3 x 1.0 ug
EUR 339
Sufu sgRNA CRISPR Lentivector set (Mouse)
K4415301 3 x 1.0 ug
EUR 339
SUFU sgRNA CRISPR Lentivector set (Human)
K2311501 3 x 1.0 ug
EUR 339
Sufu sgRNA CRISPR Lentivector (Rat) (Target 1)
K7545702 1.0 ug DNA
EUR 154
Sufu sgRNA CRISPR Lentivector (Rat) (Target 2)
K7545703 1.0 ug DNA
EUR 154
Sufu sgRNA CRISPR Lentivector (Rat) (Target 3)
K7545704 1.0 ug DNA
EUR 154
Sufu sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4415302 1.0 ug DNA
EUR 154
Sufu sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4415303 1.0 ug DNA
EUR 154
Sufu sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4415304 1.0 ug DNA
EUR 154
SUFU sgRNA CRISPR Lentivector (Human) (Target 1)
K2311502 1.0 ug DNA
EUR 154
SUFU sgRNA CRISPR Lentivector (Human) (Target 2)
K2311503 1.0 ug DNA
EUR 154
SUFU sgRNA CRISPR Lentivector (Human) (Target 3)
K2311504 1.0 ug DNA
EUR 154
SUFU Protein Vector (Rat) (pPB-C-His)
PV308882 500 ng
EUR 603
SUFU Protein Vector (Rat) (pPB-N-His)
PV308883 500 ng
EUR 603
SUFU Protein Vector (Rat) (pPM-C-HA)
PV308884 500 ng
EUR 603
SUFU Protein Vector (Rat) (pPM-C-His)
PV308885 500 ng
EUR 603
SUFU Protein Vector (Human) (pPB-C-His)
PV040777 500 ng
EUR 329
SUFU Protein Vector (Human) (pPB-N-His)
PV040778 500 ng
EUR 329
SUFU Protein Vector (Human) (pPM-C-HA)
PV040779 500 ng
EUR 329
SUFU Protein Vector (Human) (pPM-C-His)
PV040780 500 ng
EUR 329
SUFU Protein Vector (Mouse) (pPB-C-His)
PV235138 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPB-N-His)
PV235139 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPM-C-HA)
PV235140 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPM-C-His)
PV235141 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPB-C-His)
PV235142 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPB-N-His)
PV235143 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPM-C-HA)
PV235144 500 ng
EUR 603
SUFU Protein Vector (Mouse) (pPM-C-His)
PV235145 500 ng
EUR 603
Recombinant Human SUFU Protein, His, E.coli-1mg
QP13639-1mg 1mg
EUR 2757
Recombinant Human SUFU Protein, His, E.coli-20ug
QP13639-20ug 20ug
EUR 201
Recombinant Human SUFU Protein, His, E.coli-5ug
QP13639-5ug 5ug
EUR 155
Sufu 3'UTR Luciferase Stable Cell Line
TU119919 1.0 ml Ask for price
Sufu 3'UTR GFP Stable Cell Line
TU169919 1.0 ml Ask for price
Sufu 3'UTR Luciferase Stable Cell Line
TU221384 1.0 ml Ask for price
SUFU 3'UTR GFP Stable Cell Line
TU074900 1.0 ml
EUR 2333
Sufu 3'UTR GFP Stable Cell Line
TU271384 1.0 ml Ask for price
SUFU 3'UTR Luciferase Stable Cell Line
TU024900 1.0 ml
EUR 2333
Human Suppressor of fused homolog, SUFU ELISA KIT
ELI-18767h 96 Tests
EUR 824
Mouse Suppressor of fused homolog, Sufu ELISA KIT
ELI-29930m 96 Tests
EUR 865
SUFU Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV653185 1.0 ug DNA
EUR 682
SUFU Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV653189 1.0 ug DNA
EUR 682
SUFU Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV653190 1.0 ug DNA
EUR 682
SUFU Suppressor of Fused Homolog Human Recombinant Protein
PROTQ9UMX1 Regular: 20ug
EUR 317
Description: SUFU Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 504 amino acids (1-484 a.a.) and having a molecular mass of 56.1kDa.;SUFU is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7545705 3 x 1.0 ug
EUR 376
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4415305 3 x 1.0 ug
EUR 376
SUFU sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2311505 3 x 1.0 ug
EUR 376
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7545706 1.0 ug DNA
EUR 167
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7545707 1.0 ug DNA
EUR 167
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7545708 1.0 ug DNA
EUR 167
SUFU Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV653186 1.0 ug DNA
EUR 682
SUFU Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV653187 1.0 ug DNA
EUR 740
SUFU Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV653188 1.0 ug DNA
EUR 740
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4415306 1.0 ug DNA
EUR 167
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4415307 1.0 ug DNA
EUR 167
Sufu sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4415308 1.0 ug DNA
EUR 167
SUFU sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2311506 1.0 ug DNA
EUR 167
SUFU sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2311507 1.0 ug DNA
EUR 167
SUFU sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2311508 1.0 ug DNA
EUR 167
H2B Antibody Antibody
AF4659 200ul
EUR 376
Description: H2B Antibody Antibody detects endogenous levels of H2B.
CD11b Antibody Antibody
ABD2911 100 ug
EUR 438
anti- Antibody^Polyclonal antibody control antibody
LSMab09882 100 ug
EUR 438
Ly1 Antibody Reactive (LYAR) Antibody
20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Anti-Glycolipid Antibody (AGA) Antibody
20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Anti-Glycolipid Antibody (AGA) Antibody
abx036399-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
abx033330-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
abx033330-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody
20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody
20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody
20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody
20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
abx234901-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Ly1 Antibody Reactive (LYAR) Antibody
20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive (LYAR) Antibody
20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycolipid Antibody (AGA) Antibody
abx230204-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Anti-Anti-SEPT6 antibody antibody
STJ11100949 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.
Anti-Anti-SEPT9 Antibody antibody
STJ111369 100 µl
EUR 277
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.
Anti-Anti-SEPT11 Antibody antibody
STJ111530 100 µl
EUR 277
Anti-Anti-SEPT4 Antibody antibody
STJ112276 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.
Anti-Anti-SEPT2 Antibody antibody
STJ25475 100 µl
EUR 277
Anti-Anti-SEPT5 Antibody antibody
STJ25477 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-SEPT8 Antibody antibody
STJ25479 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT2 Antibody antibody
STJ28365 100 µl
EUR 277
Anti-Anti-SEPT7 Antibody antibody
STJ28963 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-MARCH9 Antibody antibody
STJ112609 100 µl
EUR 277
Anti-Anti-SEPT11 Antibody antibody
STJ113941 100 µl
EUR 277
Anti-Anti-SEPT11 Antibody antibody
STJ114081 100 µl
EUR 277
Anti-Anti-SEPT5 Antibody antibody
STJ114819 100 µl
EUR 277
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.
Anti-Anti-MARCH8 Antibody antibody
STJ114828 100 µl
EUR 277
Anti-Anti-SEPT7 Antibody antibody
STJ116214 100 µl
EUR 277
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.
Anti-Anti-SEPT8 Antibody antibody
STJ117206 100 µl
EUR 277
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-SEPT12 Antibody antibody
STJ117759 100 µl
EUR 277
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.
Anti-Anti-MARCH6 Antibody antibody
STJ118549 100 µl
EUR 277
Anti-Anti-MARCH6 Antibody antibody
STJ118550 100 µl
EUR 277
Anti-Anti-MARCH7 Antibody antibody
STJ118752 100 µl
EUR 277
Anti-Anti-SEPT3 Antibody antibody
STJ118990 100 µl
EUR 277
Anti-Anti-SEPT1 antibody antibody
STJ119580 100 µl
EUR 277
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-100ul 100ul
EUR 333
Cytokeratin 7 antibody-Cytoskeleton Marker Antibody
48169-50ul 50ul
EUR 239
Antibody Pair to ApoA-V antibody
10R-1876 100 ul
EUR 651
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody
Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody
Anti CD22 Antibody: CD22 Monoclonal Antibody
065-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody
Hepatitis C Virus Antibody (HCV) Antibody
abx023924-1mg 1 mg
EUR 1205
  • Shipped within 5-10 working days.
Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103034
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103035
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Ly1 Antibody Reactive Homolog (LYAR) Antibody
20-abx103036
  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Monoclonal NGF/proNGF Neutralizing Antibody Antibody
AMM06679G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E
Anti Deoxyribonucleic Acid Antibody (DNA) Antibody
abx411057-50ug 50 ug
EUR 592
  • Shipped within 1 week.
Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319902
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319903
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody (Biotin)
20-abx319904
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody (HRP)
20-abx319906
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-Glycoprotein Antibody (GP) Antibody (FITC)
20-abx319907
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Conduction Band Power-Degree Engineering for Bettering Open-Circuit Voltage in Antimony Selenide Nanorod Array Photo voltaic Cells

Antimony selenide (Sb2 Se3 ) nanorod arrays alongside the [001] orientation are identified to switch photogenerated carriers quickly as a result of strongly anisotropic one-dimensional crystal construction. With superior light-trapping constructions, the Sb2 Se3 nanorod array-based photo voltaic cells have glorious broad spectral response properties, and better short-circuit present density than the traditional planar structured skinny movie photo voltaic cells. Nevertheless, the interface engineering for the Sb2 Se3 nanorod array-based photo voltaic cell is extra essential to extend the efficiency, as a result of it’s difficult to coat a compact buffer layer with good protection to type a uniform heterojunction interface attributable to its massive floor space and length-diameter ratio.

On this work, an intermeshing In2 S3 nanosheet-CdS composite because the buffer layer, compactly coating on the Sb2 Se3 nanorod floor is constructed. The appliance of In2 S3 -CdS composite buffers construct a gradient conduction band power configuration within the Sb2 Se3 /buffer heterojunction interface, which reduces the interface recombination and enhances the switch and assortment of photogenerated electrons. The energy-level regulation minimizes the open-circuit voltage deficit on the interfaces of buffer/Sb2 Se3 and buffer/ZnO layers within the Sb2 Se3 photo voltaic cells. Consequently, the Sb2 Se3 nanorod array photo voltaic cell primarily based on In2 S3 -CdS composite buffers achieves an effectivity of as excessive as 9.19% with a VOC of 461 mV.

Distinguishing between Isomeric Neoxanthin and Violaxanthin Esters in Yellow Flower Petals utilizing Liquid Chromatography-Photodiode Array Atmospheric Stress Chemical Ionization Mass Spectrometry and MS/MS

Rationale: Liquid chromatography-photodiode array atmospheric strain chemical ionization mass spectrometry (LC-PDA-APCI-MS) is used for the evaluation of assorted carotenoid pigments in crops. Amongst them, it’s tough to differentiate between the isomeric violaxanthin/neoxanthin esters.

Strategies: The yellow pigments of tomato petals have been extracted with acetone, and the extracts have been saved at -30°C to settle out the contaminating triacylglycerols bodily. The supernatants have been analyzed utilizing LC-PDA-APCI-MS with a high-resolution orbitrap MS for his or her precise lots. The anticipated carotenoid esters have been calculated with the mixture of carotenoids and fatty acids, they usually have been matched with the experimental precise lots. The fatty acid constructions within the carotenoid esters have been additionally recognized utilizing collision-induced dissociation (CID) MS/MS. The isomeric violaxanthin/neoxanthin esters have been distinguished utilizing CID MS/MS from their in-source dehydrated product ions as pseudoprecursor ions.

Outcomes: The in-source dehydrated ions [M-H2 O+H]+ of neoxanthin diesters predominated over their protonated molecules [M+H]+ within the LC-MS. Against this, the protonated molecules of violaxanthin diesters predominated. The 92 u loss product ions [M-H2 O-C7 H8 +H]+ have been noticed from the dehydrated violaxanthin diesters, however they weren’t generated from the dehydrated neoxanthin diesters within the CID MS/MS of their dehydrated pseudoprecursor ion [M-H2 O+H]+ .

Conclusions: The allene allyl carbocation in neoxanthin diesters was generated from dehydration after preferential protonation on the hydroxy group. The epoxide group of violaxanthin diesters opens simply after protonation; nonetheless, the dehydration didn’t proceed at this stage. The 92 u lack of C7 H8 was defined by the intramolecular [2+2] cycloaddition, which proceeded preferentially in dehydrated violaxanthin diesters as a result of the carbocations within the dehydrated species have been conjugated to the polyene and people double bonds have been depolarized within the CID MS/MS. Due to this fact, the isomeric neoxanthin/violaxanthin diesters have been distinguished utilizing LC-PDA-APCI-MS and MS/MS. This technique was a sensible and helpful technique of profiling the carotenoid esters of the yellow petals.

Beam pen lithography as a brand new software for spatially managed photochemistry, and its utilization within the synthesis of multivalent glycan arrays

Herein, we describe how cantilever-free scanning probes can be utilized to deposit precursor materials and subsequently irradiate the precursor to provoke polymerization, leading to a 3D lithographic technique whereby the place, peak and diameter of every function may be tuned independently. Particularly, acrylate and methacrylate monomers have been patterned onto thiol terminated glass and subsequently uncovered to UV mild produced brush polymers by a photoinduced radical acrylate polymerization response. Right here, we report the primary examples of glycan arrays, comprised of methacrylate brush polymers which are side-chain functionalized with α-glucose, by this new lithographic method.

Their binding with fluorophore labeled concanavalin A (ConA) was assayed by fluorescence microscopy. The fluorescence of those brush polymers was in comparison with glycan arrays composed of monolayers of α-mannosides and α-glucosides ready by combining polymer pen lithography (PPL) with the thiol-ene photochemical response or the copper-catalyzed azide-alkyne cycloaddition. At excessive ConA focus, the fluorescence sign of the brush polymer was practically 20 occasions better than that of the glycan monolayers, and the comb polymer arrays had a detection restrict practically two orders of magnitude higher than their monolayer counterparts.

Due to the potential of this technique to manage exactly the polymer size, the connection between restrict of detection and multivalency could possibly be explored, and it was discovered that the longer polymers (136 nm) are an order of magnitude extra delicate in the direction of ConA binding than the shorter polymers (Eight nm) and that binding affinity decreased systematically with size. These glycan arrays are a brand new software to check the function of multivalency on carbohydrate recognition, and the photopolymerization route in the direction of forming multivalent glycan scaffolds described herein, is a promising path to create multiplexed glycan arrays with nanoscale function dimensions.

Leave a Reply

Your email address will not be published. Required fields are marked *